CARD ID | 2372 | |
Type of strain | Targeted mutant. | |
Strain name | B6;BDF1-Gtsf1ltm1Miya | |
Internal Code | Gtsf1l KO | |
Submitter | Miyazaki Jun-ichi | |
Submitter affiliation or code | Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | Miya | |
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Gtsf1l |
Gene name | gametocyte specific factor 1-like |
Allele symbol | Gtsf1ltm1Miya |
Allele name | gametocyte specific factor 1-like, targeted mutation 1, |
MGI | MGI:1915486, |
Chromosome | 2 (84.04) (2H3) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection, Other |
OMIM |
Gtsf1l-Bam-F | aaaggatccgctcttgtacctgcctgagttaacg |
Gtsf1l-Eco-R | tttgaattctagaagtttgccttcctggtcctag |
Disease name, Applicable field | Reproduction |