| CARD ID | 385 | |
| Type of strain | Transgenic. | |
| Strain name | B6;C-Tg(Mt1-RET)242Num | |
| Internal Code | B6;C-Tg(Mt1-RFP/RET)242Num | |
| Submitter | Kato Masashi | |
| Submitter affiliation or code | Nagoya University Graduate School of Medicine Department of Occupational and Environmental Health | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Nagoya University Graduate School of Medicine |
| Organization code | Num | |
| Developer | Masashi Kato | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ret |
| Gene name | Ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease)(Human) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:97902, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| GO | Gene Ontology |
| OMIM | OMIM ID: 164761 Human Gene Symbol: RET, |
| primerA | 5'(aaaatgcagtcagatatgga)3' |
| primerB | 5'(actcggggaggcgttc)3' |
| Author | Masashi Kato Nakajima Izumi Masahide Takahashi |
| Title | Mouse models for Hirschsprung's disease and Malignant melanoma |
| Journal | Pathology and clinical |
| Volume | 16 |
| Page | 1149-1152 |
| Year | 1998 |
| PMID |
| Author | Takashi Iwamoto, Masahide Takahashi, Masafumi Ito, Kiyohiro Hamatani, Masaharu Ohbayashi, Worawidh Wajjwalku, Ken-ichi Isobe and Izumi Nakashima |
| Title | Aberrant melanogenesis and melanocytic tumour development in transgenic mice that carry a metallothionein/ret fusion gene |
| Journal | The EMBO Journal |
| Volume | 10 |
| Page | 3167-3175 |
| Year | 1991 |
| PMID | 1915289 |
| Disease name, Applicable field | cancer, Dermatology |