CARD ID | 2992 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6J-Wnt2bem2Cre/ERT2) | |
Internal Code | Wnt2b-2A-CreERT2 (No.36) | |
Submitter | Takahashi Masanori | |
Submitter affiliation or code | Center for Molecular Medicine, Jichi Medical University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Jichi Medical University |
Organization code | ||
Developer | Masanori Takahashi | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Wnt2b |
Gene name | wingless-type MMTV integration site family, member 2B |
Allele symbol | Wnt2bem2Cre/ERT2) |
Allele name | wingless-type MMTV integration site family, member 2B; endonuclease-mediated mutation 2, |
MGI | MGI:1261834, |
Chromosome | 3 (45.88) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
Wnt2b screening 5Fw (28 mer) | TTAATCTCAGTTTGGCCCCCATTGTACT |
Cre Tm68 R2 (28 mer) | CTTTTGCAAGGAATGCGATGAAGTAGAG |
Author | Masanori Takahashi , Takayuki Isagawa , Tatsuyuki Sato , Norihiko Takeda , Kiyoshi Kawakami |
Title | Lineage tracing using Wnt2b-2A-CreERT2 knock-in mice reveals the contributions of Wnt2b-expressing cells to novel subpopulations of mesothelial/epicardial cell lineages during mouse development |
Journal | Genes Cells |
Volume | |
Page | DOI: 10.1111/gtc.13147 |
Year | 2024 |
PMID | 39109760 |
Disease name, Applicable field | Development |