CARD ID | 1882 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Ffar1tm1Gdds | |
Internal Code | gpr40KOB6 | |
Submitter | Akira Hirasawa | |
Submitter affiliation or code | Department of Genomic Drug Discovery Science Graduate School of Pharmaceutical Sciences, Kyoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | Gdds | |
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ffar1 |
Gene name | Ffar1, free fatty acid receptor 1 |
Allele symbol | Ffar1tm1Gdds |
Allele name | targeted mutation 1; Gozoh Tsujimoto |
MGI | MGI:2684079, |
Chromosome | 7 (19.25 ) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
40-S1 | TAGGACTGGCTTCTGGTGCT |
40-AS2,3primer-neo(primer3) | CCTCCTGAGTTGTGGTGGAT,GGCTATTCGGCTATGACTGG |
Disease name, Applicable field | Obesity, Diabetes |