CARD R-BASE



Mouse strain


Strain information

CARD ID 1126
Type of strain Targeted mutant.
Strain name B6.129-Cthtm1
Internal Code Cth-Knockout
Submitter ISHII ISAO
Submitter affiliation or code Showa Pharmaceutical University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Showa Pharmaceutical University
Organization code 不明
Developer Isao Ishii
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Cth
Gene name cystathionase (cystathionine gamma-lyase)
Allele symbol Cthtm1
Allele name cystathionase (cystathionine gamma-lyase); targeted mutation
MGI MGI:1339968,
Chromosome 3 (3H4) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
Cth-1(CSE-F2) TGCCGACCAATAAGCAGGGC
Cth-2(CSE-PCR-1) AAAATCACGTTGTTGGTCAA


References

Author Yamada H, Akahoshi N, Kamata S, Hagiya Y, Hishiki T, Nagahata Y, et al.
Title Methionine excess in diet induces acute lethal hepatitis in mice lacking cystathionine gamma-lyase, an animal model of cystathioninuria.
Journal Free Radic Biol Med
Volume 52
Page 1716-1726
Year 2012
PMID
Author Akahoshi N, Kamata S, Kubota M, Hishiki T, Nagahata Y, Matsuura T, et al.
Title Neutral aminoaciduria in cystathionine beta-synthase-deficient mice, an animal model of homocystinuria.
Journal Am J Physiol Renal Physiol
Volume 306
Page F1462-F1476
Year 2014
PMID
Author Hagiya Y, Kamata S, Mitsuoka S, Okada N, Yoshida S, Yamamoto J, et al.
Title Hemizygosity of transsulfuration genes confers increased vulnerability against acetaminophen-induced hepatotoxicity in mice.
Journal Toxicol Appl Pharmacol
Volume 282
Page 195-206
Year 2015
PMID
Author Nakano S, Ishii I, Shinmura K, Tamaki K, Hishiki T, Akahoshi N, et al.
Title Hyperhomocysteinemia abrogates fasting-induced cardioprotection against ischemia/reperfusion by limiting bioavailability of hydrogen sulfide anions.
Journal J Mol Med
Volume 93
Page 879-889
Year 2015
PMID
Author Szijarto IA, Marko L, Filipovic MR, Miljkovic JL, Tabeling C, Tsvetkov D, et al.
Title Cystathionine gamma-lyase-produced hydrogen sulfide controls endothelial NO bioavailability and blood pressure.
Journal Hypertension
Volume 71
Page 1210-1217
Year 2018
PMID
Author Isao Ishii, Noriyuki Akahoshi, Hidenori Yamada, Shintaro Nakano, Takashi Izumi, and Makoto Suematsu
Title Cystathionine gamma-Lyase-deficient Mice Require Dietary Cysteine to Protect against Acute Lethal Myopathy and Oxidative Injury
Journal J. Biol. Chem.
Volume 285
Page 26358-26368
Year 2010
PMID


Disease , Applicable field information

Disease name, Applicable field Physiology, Development, Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.