CARD ID | 2359 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Ptger2tm1 | |
Internal Code | EP2KO(lacZ) | |
Submitter | Sugimoto Yukihiko | |
Submitter affiliation or code | Department of Phamaceutical Biochemistry, Graduate School of Phamaceutical Sciences, Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
No condition
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | Yukihiko Sugimoto | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ptger2 |
Gene name | prostaglandin E receptor 2 (subtype EP2) |
Allele symbol | Ptger2tm1 |
Allele name | prostaglandin E receptor 2 (subtype EP2), targeted mutation 1, |
MGI | MGI:97794, |
Chromosome | 14 (22.68) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
Puro1 | TAATTCCATCAGAAGCTGGTCGACCTCG |
2716 | CTGAGCAACACCCATGTTTCTATCCTGG |
Disease name, Applicable field |