CARD ID | 1908 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6N-Hnf1atm1Card | |
Internal Code | C57BL/6N-Hnf1atm1 | |
Submitter | Ken-ichi YAMAMURA | |
Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Institute of Resource Development and Analysis, Kumamoto University |
Organization code | Card | |
Developer | Ken-ichi Yamamura | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Hnf1a |
Gene name | HNF1 homeobox A |
Allele symbol | |
Allele name | HNF1 homeobox A, targeted mutation 1, Naomi Nakagata, Center for Animal Resources and Development, Kumamoto University |
MGI | MGI:98504, |
Chromosome | 5 (55.99) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
5AF4 | AAGGCGCGCCATGAGAACGTTGGTGCTACAG |
Neo100 | AGGTGAGATGACAGGAGATC |
Disease name, Applicable field | Laboratory-animal Science, Diabetes, Urology, Metabolism, Digestive Disorders |