| CARD ID | 3374 | |
| Type of strain | Targeted mutant. | |
| Strain name | C3H/HeN-Sytl1tm1 | |
| Internal Code | Exo7 KO マウス | |
| Submitter | Katsuhide Okunishi | |
| Submitter affiliation or code | Institute for Molecular and Cellular Regulation, Gunma University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
1. Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITORs using the Approval Form. 2. The availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for profit institution for a not-for-profit research. 3. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITORs is requested. 4. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITORs is requested. 5. The RECIPIENT must contact the DEPOSITORs in the case of application for any patents or commercial use based on the results from the use of the BIOLOGICAL RESOURCE. |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Institute for Molecular and Cellular Regulation, Gunma University |
| Organization code | ||
| Developer | Hiroshi Gomi, Tetsuro Izumi | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sytl1 |
| Gene name | synaptotagmin-like 1 |
| Allele symbol | Sytl1tm1 |
| Allele name | synaptotagmin-like 1; targeted mutation 1, |
| MGI | MGI:1933365, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Exo7/Fow2 | CAGCTGATGCCCCAGAGAGGC |
| Exo7/Rev | TCTCGTTTGAGGACATCAGAGATG |
| neofow2/Fow | CTTGACGAGTTCTTCTGAGG |
| Author | Hao Wang, Ray Ishizaki, Jun Xu, Kazuo Kasai, Eri Kobayashi, Hiroshi Gomi, Tetsuro Izumi |
| Title | The Rab27a effector exophilin7 promotes fusion of secretory granules that have not been docked to the plasma membrane |
| Journal | Mol Biol Cell |
| Volume | 24 |
| Page | 319-30 |
| Year | 2013 |
| PMID | 23223571 |
| Disease name, Applicable field | Metabolism, Diabetes, Cell biology, Molecular biology |