| CARD ID | 3082 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Stra8em1(GFP)/29 | |
| Internal Code | Stra8-null GFP #29 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Stra8 |
| Gene name | Stimulated by retinoc acid 8 |
| Allele symbol | Stra8em1(GFP) |
| Allele name | stimulated by retinoic acid gene 8; endonuclease-mediated mutation 1, |
| MGI | MGI:107917, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Stra8 int8F | tggtttctcatttctccctgctgac |
| KI92ES-29564R | agaaggcttttggaagcagcctttc |
| St8-delHLH 1F | caaggctaaaggggggtatattatg |
| Author | Ishiguro K, Matsuura K, Tani N, Takeda N, Usuki S, Yamane M, Sugimoto M, Fujimura S, Hosokawa M, Chuma S, Ko S.H.M, Araki K, Niwa H. |
| Title | MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells. |
| Journal | Dev. Cell |
| Volume | 52(4) |
| Page | 429-445 |
| Year | 2020 |
| PMID |
| Disease name, Applicable field | Reproduction, Cell biology |