| CARD ID | 2248 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(CAG-LSL-Spink3)10Card | |
| Internal Code | CAG promoter-LSL-Spink3 line 10 | |
| Submitter | Ohmuraya Masaki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Spink3 |
| Gene name | Serine protease inhibitor, Kazal type 3 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:106202, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | electroporation |
| OMIM |
| mPsti5 | TGTGTGGGACTGACGGAATTAC |
| mPsti6 | AGGACAGGCTCTATGCGTTTC |
| Disease name, Applicable field | Digestive Disorders |