CARD ID | 2737 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Rad21Lem1(Rad21L-3xFLAG-HA-GFP) | |
Internal Code | Rad21L KI | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Rad21L |
Gene name | RAD21-like (S. pombe) |
Allele symbol | Rad21Lem1(Rad21L-3xFLAG-HA-GFP) |
Allele name | RAD21-like (S. pombe); endonuclease-mediated mutation 1, |
MGI | MGI:3652039, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
59_rad21L-Left2-R | GGCTCTTTATAATTGCATATTAGAG |
96_rad21L_5arm_F1 | GTTGGCAAAACAGACAGAGTCATGC |
Disease name, Applicable field | Cell biology, Molecular biology |