CARD R-BASE



Mouse strain


Strain information

CARD ID 2651
Type of strain Targeted mutant.
Strain name C57BL/6N-Vps52tm2.1Card
Internal Code Vps52VADmut
Submitter Araki Kimi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer Kimi Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Vps52
Gene name VPS52 GARP complex subunit
Allele symbol Vps52tm2.1Card
Allele name VPS52 GARP complex subunit, targeted mutation 2.1,
MGI MGI:1330304,
Chromosome 17 (17.98) (17qB1) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Vps52_genome_F18 cctttgattctgattaagcctgc
Vps52VAD_R4 tacccctgcaagttctgtca


References

Author Michihiko Sugimoto, Masayo Kondo, Michiko Hirose, Misao Suzuki, Kazuyuki Mekada, Takaya Abe, Hiroshi Kiyonari, Atsuo Ogura, Nobuo Takagi, Karen Artzt, and Kuniya Abe
Title Molecular Identification of tw5: Vps52 Promotes Pluripotential Cell Differentiation through Cell–Cell Interactions
Journal Cell Reports
Volume 2
Page 1363-1374
Year 2012
PMID


Disease , Applicable field information

Disease name, Applicable field Development, Laboratory-animal Science, Hematology






Copyright @ 2021 Kumamoto University. All rights reserved.