CARD R-BASE



Mouse strain


Strain information

CARD ID 1883
Type of strain Targeted mutant.
Strain name B6;CB-Gt(pU-21B)210Imegtm1(CAG-SPINK1)Card
Internal Code B210-CAG-SPINK1 knockin mouse
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Center for Animal Resources & Development (CARD), Kumamoto University
Organization code Card
Developer Ken-ichi Yamamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Diap2
Gene name Drosophila inhibitor of apoptosis 2
Allele symbol Gt(Ayu21-B)137Imegtm1.1(CAG-SPINK1)46Card
Allele name Gt(pU-21B)210Imeg, targeted mutation 1, Naomi Nakagata Center for Animal Resources & Development
MGI
Chromosome X (52.36) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
SPINK1-1-1 gaaggtaacaggcatctttcttctc
SPINK1-1-2 atctctttacctctcttcccaggg


Disease , Applicable field information

Disease name, Applicable field cancer






Copyright @ 2021 Kumamoto University. All rights reserved.