CARD ID | 2148 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Pdilttm1Osb/70 | |
Internal Code | Pdilt KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Pdilt |
Gene name | protein disulfide isomerase-like, testis expressed |
Allele symbol | Pdilttm1Osb |
Allele name | protein disulfide isomerase-like, testis expressed, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
MGI | MGI:1919080, |
Chromosome | 7 (63.90) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
4484 | atggaactgctttggacacc |
4485 | aatactcacggaaaatcacc |
114 | ATCTggACgA AgAgCATCAg |
Disease name, Applicable field |