| CARD ID | 2155 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Pate4tm1(KOMP)Osb3A | |
| Internal Code | Pate4 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Pate4 |
| Gene name | prostate and testis expressed 4 |
| Allele symbol | Pate4tm1(KOMP)Osb3A |
| Allele name | prostate and testis expressed 4, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1930790, |
| Chromosome | 9 (20.34) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| #5319 | ATCCGGGGGTACCGCGTCGAG |
| #5897 | GGTAAGTGGGGCTGATACAGACTCC |
| #5898 | CCTTGCACTGAGGCGAGCAC |
| Author | Noda T, Fujihara Y, Matsumura T, Oura S, Kobayashi S, Ikawa M. |
| Title | Seminal vesicle secretory protein 7, PATE4, is not required for sperm function but for copulatory plug formation to ensure fecundity. |
| Journal | Biol Reprod. |
| Volume | 100(4) |
| Page | 1035-1045 |
| Year | 2019 Apr 19 |
| PMID |
| Disease name, Applicable field | Development |