CARD ID | 2175 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Fer1l6tm1a(KOMP)Osb/91 | |
Internal Code | Fer1l6 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Fer1l6 |
Gene name | fer-1-like 6 (C. elegans) |
Allele symbol | Fer1l6tm1a(KOMP)Osb/91 |
Allele name | fer-1-like 6 (C. elegans); targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University, |
MGI | MGI:3645398, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
Fer1l6-both | CCATCATTGCCTCTGCCTTTCT |
Fer1l6-WT | CCATCATGGATCTTAGTCAGCAGT |
LAR3 | CACAACGGGTTCTTCTGTTAGTCC |
Author | Akane Morohoshi, Haruhiko Miyata, Keizo Tokuhiro, Rie Iida-Norita, Taichi Noda, Yoshitaka Fujihara, Masahito Ikawa |
Title | Testis-enriched ferlin, FER1L5, is required for Ca2+-activated acrosome reaction and male fertility |
Journal | Sci Adv. |
Volume | 9(4) |
Page | |
Year | 2023 |
PMID | 36696506 |
Disease name, Applicable field |