CARD ID | 2616 | |
Type of strain | Transgenic. | |
Strain name | B6D2-Tg(Clgn-Ppp3cc,FLAG)Osb/1 | |
Internal Code | Ppp3cc-FLAG Tg #1 | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ppp3cc |
Gene name | Ppp3cc |
Allele symbol | Tg(Clgn-Ppp3cc,FLAG)Osb/1 |
Allele name | transgene insertion, Research Institute for Microbial Diseases, Osaka University |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | |
OMIM |
Ppp3ccflagFw | CCCGAATTCGGAGCCGGGAGGAGACCATGT |
Ppp3ccflagRv | GAATTTATCGTCGTCATCCTTATAATC |
Author | Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. |
Title | Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. |
Journal | Science |
Volume | 350(6259) |
Page | 442-5 |
Year | 2015 |
PMID |
Disease name, Applicable field |