CARD ID | 2165 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Lypd4tm1Osb/6A | |
Internal Code | Lypd4 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Lypd4 |
Gene name | Ly6/Plaur domain containing 4 |
Allele symbol | Lypd4tm1Osb |
Allele name | Ly6/Plaur domain containing 4, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:2687054, |
Chromosome | 7 (13.30) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
#719 | GCCTTCTATCGCCTTCTTGACGAGTTCTTC |
#6156 | CTAGGGATTACTGGCAAGAACGGGG |
#6157 | GGGTTGACTGGCCTTGAGTCTCAC |
Author | Yoshitaka Fujihara, Taichi Noda, Kiyonori Kobayashi, Asami Oji, Sumire Kobayashi, Takafumi Matsumura, Tamara Larasati, Seiya Oura, Kanako Kojima-Kita, Zhifeng Yu, Martin M. Matzuk, and Masahito Ikawa |
Title | Identification of multiple male reproductive tract-specific proteins that regulate sperm migration through the oviduct in mice |
Journal | Proc Natl Acad Sci U S A. |
Volume | 116(37) |
Page | 18498-18506 |
Year | 2019 |
PMID |
Disease name, Applicable field |