CARD ID | 441 | |
Type of strain | Gene trap. | |
Strain name | B6;CB-Slc7a2Gt(pU-21)128Imeg | |
Internal Code | Ayu21-128 | |
Submitter | Ken-ichi YAMAMURA | |
Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Institute of Molecular Embryology and Genetics Kumamoto University |
Organization code | Imeg | |
Developer | Kimi Araki | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Slc7a2 |
Gene name | solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
Allele symbol | Slc7a2Gt(Ayu21)128Imeg |
Allele name | targeted mutation 128, Institute of molecular embryology and genetics |
MGI | MGI:99828, |
Chromosome | 8 , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
GO | Gene Ontology |
OMIM | OMIM ID: 601872 Human Gene Symbol: SLC7A2, |
Z-1 | GCGTTACCCAACTTAATCG |
Z-2 | TGTGAGCGAGTAACAACCCG |
Author | |
Title | |
Journal | |
Volume | |
Page | |
Year | |
PMID |
Disease name, Applicable field | Development |
EGTC番号 | 21-128 |