| CARD ID | 3253 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-2610318N02Rikem1 | |
| Internal Code | 2610318N02Rik-#1 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | 2610318N02Rik |
| Gene name | RIKEN cDNA 2610318N02 gene |
| Allele symbol | 2610318N02Rikem1 |
| Allele name | RIKEN cDNA 2610318N02 gene ; endonuclease-mediated mutation 1, |
| MGI | MGI:1917708, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Primer1(2610318N02Rik-genome-1F) | GCAGAGTTACCTTTAGCGGC |
| Primer2 (2610318N02Rik-genome-1R) | AGCTGCTGACACACGTCTAC |
| Primer1(2610318N02Rik-genome-1F) | GCAGAGTTACCTTTAGCGGC |
| Primer3(2610318N02Rik-genome-2R) | GAGCAAGGACTATGACAGCCA |
| Disease name, Applicable field | Reproduction, Cell biology |