CARD R-BASE



Mouse strain


Strain information

CARD ID 1093
Type of strain Targeted mutant.
Strain name B6.129-Edg3tm1Jch
Internal Code SIP3-Knockout
Submitter ISHII ISAO
Submitter affiliation or code Showa Pharmaceutical University
Stock Type
Material Transfer Conditions Consent to us
Production method From other organizations
Origin (In-house) Organization Showa Pharmaceutical University
Organization code
Developer Isao Ishii
Origin (From other organizations) Organization The Scripps Research Institute
Organization code Jch
Developer Dr. Jerold Chun
Year introduced 2005 / 4
Introduced Generation N5+F?
Remarks


Gene information

Gene symbol Edg3
Gene name endothelial differentiation, sphingolipid G-protein-coupled receptor,3
Allele symbol Edg3tm1Jch
Allele name targeted mutation 1, Jerold Chun
MGI
Chromosome 13 (13B1) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
Edg3-1(HX1) ATCGATACCGTCGTCGACCT
Edg3-2(B3-back) CACAGCAAGCAGACCTCCAGA


References

Author Means CK, Xiao CY, Li Z, Zhang T, Omens JH, Ishii I, et al.
Title Sphingosine 1-phosphate S1P2 and S1P3 receptor-mediated Akt activation protects against in vivo myocardial ischemia-reperfusion injury.
Journal Am J Physiol Heart Circ Physiol
Volume 292
Page H2944-H2951
Year 2007
PMID
Author Takuwa N, Ohkura S, Takashima S, Ohtani K, Okamoto Y, Tanaka T, et al.
Title S1P3-mediated cardiac fibrosis in sphingosine kinase 1 transgenic mice involves reactive oxygen species.
Journal Cardiovasc Res
Volume 85
Page 484-493
Year 2010
PMID
Author Isao Ishii, Beth Friedman, Xiaoqin Ye, Shuji Kawamura, Christine McGiffert, James J. A. Contos, Marcy A. Kingsbury, Guangfa Zhang, Joan Heller Brown, and Jerold Chun
Title Selective Loss of Sphingosine 1-Phosphate Signaling with No Obvious Phenotypic Abnormality in Mice Lacking Its G Protein-coupled Receptor,LPB3/EDG-3
Journal J. Biol. Chem.
Volume 276
Page 33697-33704
Year 2001
PMID


Disease , Applicable field information

Disease name, Applicable field Physiology, Development, Immunology, Neurobiology, Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.