CARD ID | 2361 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(Cdh5-CreERT2) | |
Internal Code | Cdh5-BAC-CreERT2 | |
Submitter | Kubota Yoshiaki | |
Submitter affiliation or code | School of Medicine, Keio University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | School of Medicine, Keio University |
Organization code | ||
Developer | Yoshiaki Kubota | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Cdh5-CreERT2 |
Gene name | Cdh5-CreERT2 |
Allele symbol | |
Allele name | transgene insertion |
MGI | |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection microinjection |
OMIM |
Cre1 | GCGGTCTGGCAGTAAAAACTATC |
Cre2 | GTGAAACAGCATTGCTGTCACTT |
Author | Okabe K, Kobayashi S, Yamada T, Kurihara T, Tai-Nagara I, Miyamoto T, Mukouyama YS, Sato TN, Suda T, Ema M and Kubota Y |
Title | Neurons limit angiogenesis by titrating VEGF in retina |
Journal | Cell |
Volume | 159 |
Page | 584-596 |
Year | 2014 |
PMID |
Disease name, Applicable field | Anatomy, Molecular biology, Development, Cell biology, Diabetes, cancer, Dermatology, Neurobiology, Hematology, Ophthalomology |