| CARD ID | 2779 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Gm6653em2 | |
| Internal Code | Gm6653-Line#20 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gm6653 |
| Gene name | predicted gene 6653 |
| Allele symbol | Gm6653em2 |
| Allele name | predicted gene 6653; endonuclease-mediated mutation 2, |
| MGI | MGI:3647484, |
| Chromosome | 10 (43.70) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Gm6653_genotype_F | CTAACAACGAAGATTCGCTTGCTGG |
| Gm6653_genotype_R2 | CTGAATAGTCCACTTACATAGGGGG |
| Disease name, Applicable field | Cell biology, Reproduction |