CARD R-BASE



Mouse strain


Strain information

CARD ID 1829
Type of strain Targeted mutant.
Strain name C57BL/6-Nenftm1Kyo
Internal Code Neudesin knock out mouse
Submitter Nobuyuki Itoh
Submitter affiliation or code Department of Genetic Biochemistry, Kyoto University Graduate School of Pharmaceutical Sciences
Stock Type
Material Transfer Conditions Consent to us
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code 不明
Developer
Year introduced 2009
Introduced Generation F1
Remarks


Gene information

Gene symbol Nenf
Gene name neuron derived neurotrophic factor
Allele symbol Nenftm1
Allele name targeted mutation 1
MGI MGI:1913458,
Chromosome 1 (96.28) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
genotype-Neos agcgaaggagcaaagctgctattg
genotype-Neua ggccatcctggtctacctagaaat


Disease , Applicable field information

Disease name, Applicable field Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.