CARD R-BASE



Mouse strain


Strain information

CARD ID 1073
Type of strain Targeted mutant.
Strain name B6.129-S1pr2tm1Jch
Internal Code SIP2-Knockout
Submitter ISHII ISAO
Submitter affiliation or code Showa Pharmaceutical University
Stock Type
Material Transfer Conditions Consent to us
Production method From other organizations
Origin (In-house) Organization Showa Pharmaceutical University
Organization code
Developer Isao Ishii
Origin (From other organizations) Organization The Scripps Research Institute
Organization code Jch
Developer Dr. Jerold Chun
Year introduced 2005 / 4
Introduced Generation N5+F?
Remarks


Gene information

Gene symbol S1pr2 (Synonym: Edg5)
Gene name Endothelial differentiation, sphingolipid G-protein-coupled receptor,5
Allele symbol S1pr2tm1Jch
Allele name targeted mutation 1, Jerold Chun
MGI
Chromosome 9 (6.0) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
Edg5-1(B2-neo) GCTAAAGCGCATGCTCCAGACT
Edg5-2(B2-SA) ACACCCTTTGTATCAAGTGGCAA


References

Author Imasawa T, Koike K, Ishii I, Chun J, Yatomi Y.
Title Blockade of sphingosine 1-phosphate receptor 2 signaling attenuates streptozotocin-induced apoptosis of pancreatic beta-cells.
Journal Biochem Biophys Res Commun
Volume 392
Page 207-211
Year 2010
PMID
Author Akahoshi N, Ishizaki Y, Yasuda H, Murashima YL, Shinba T, Goto K, et al.
Title Frequent spontaneous seizures followed by spatial working memory/anxiety deficits in mice lacking sphingosine 1-phosphate receptor 2.
Journal Epilepsy Behav
Volume 22
Page 659-665
Year 2011
PMID
Author Kitada Y, Kajita K, Taguchi K, Mori I, Yamauchi M, Ikeda T, et al.
Title Blockade of sphingosine 1-phosphate receptor 2 signaling attenuates high-fat diet-induced adipocyte hypertrophy and systemic glucose intolerance in mice.
Journal Endocrinology
Volume 157
Page 1839-1851
Year 2016
PMID
Author Isao Ishii, Xiaoqin Ye, Beth Friedman, Shuji Kawamura, James J. A. Contos, Marcy A. Kingsbury, Amy H. Yang, Guangfa Zhang, Joan Heller Brown, and Jerold Chun
Title Marked Perinatal Lethality and Cellular Signaling Deficits in Mice Null for the Two Sphingosine 1-Phosphate (S1P) Receptors, S1P2/LPB2/EDG-5 and S1P3/LPB3/EDG-3
Journal J. Biol. Chem.
Volume 277
Page 25152-25159
Year 2002
PMID


Disease , Applicable field information

Disease name, Applicable field Physiology, Development, Immunology, Dermatology, Neurobiology, Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.