CARD ID | 2144 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Tepptm1a(KOMP)Osb/88 | |
Internal Code | Tepp KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Tepp |
Gene name | testis, prostate and placenta expressed |
Allele symbol | Tepptm1a(KOMP)Osb |
Allele name | testis, prostate and placenta expressed, targeted mutation 1a,Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
MGI | MGI:1920657, |
Chromosome | 8 , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
#5083 | actgatggcgagctcagacc |
#5381 | tcaactatctgactccctgg |
#5862 | gagtatcttggagtccccatctcaccc |
#5863 | ggatcttggttaggggttgcaagcg |
Author | H. Miyata, J.M. Castaneda, Y. Fujihara, Z. Yu, D.R. Archambeault, A. Isotani, D. Kiyozumi, M.L. Kriseman, D. Mashiko, T. Matsumura, R.M. Matzuk, M. Mori, T. Noda, A. Oji, M. Okabe, R. Prunskaite-Hyyrylainen, R. Ramirez-Solis, Y. Satouh, Q. Zhang, M. Ikawa, M.M. Matzuk |
Title | Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice |
Journal | Proc. Natl. Acad. Sci. |
Volume | 113 |
Page | 7704-7710 |
Year | 2016 |
PMID |
Disease name, Applicable field | Development |