CARD R-BASE



Mouse strain


Strain information

CARD ID 3305
Type of strain Targeted mutant.
Strain name C57BL/6-Hhatltm1
Internal Code Mg56
Submitter Hiroshi Takeshima
Submitter affiliation or code Kyoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Kyoto University
Organization code
Developer Hiroshi Takeshima
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Hhatl
Gene name hedgehog acyltransferase-like
Allele symbol Hhatltm1
Allele name hedgehog acyltransferase-like; targeted mutation 1,
MGI MGI:1922020,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Primer1 gagtggaccagtctcctcagag
Primer2 gctgccaactgtgtctctactc


References

Author Van B, Nishi M, Komazaki S, Ichimura A, Kakizawa S, Nakanaga K, Aoki J, Park KH, Ma J, Ueyama T, Ogata T, Maruyama N, Takeshima H.
Title Mitsugumin 56 (hedgehog acyltransferase-like) is a sarcoplasmic reticulum-resident protein essential for postnatal muscle maturation
Journal FEBS Letter
Volume 589
Page 1095-1104
Year 2015
PMID 25841338


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.