CARD ID | 779 | |
Type of strain | Transgenic. | |
Strain name | B6;C3H-Tg(TRE-Ptgs2/TRE-Ptges)#7 | |
Internal Code | TRE-mPGES-1 | |
Submitter | Masanobu Oshima | |
Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Cancer Research Institute, Kanazawa Univ. |
Organization code | ||
Developer | Hiroko Oshima | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ptges |
Gene name | prostaglandin E synthase |
Allele symbol | |
Allele name | |
MGI | MGI:1927593, |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM | OMIM ID: 605172 Human Gene Symbol: PTGES, |
Gene symbol | Ptgs2 |
Gene name | prostaglandin-endoperoxide synthase 2 |
Allele symbol | |
Allele name | |
MGI | MGI:97798, |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
GO | Gene Ontology |
OMIM | OMIM ID: 600262 Human Gene Symbol: PTGS2, |
COX-2-F3 | CAAACTCAAGTTTGACCCAG |
COX-2-R1 | CTTTTACAGCTCAGTTGAACG |
Disease name, Applicable field | Physiology, cancer, Metabolism |