CARD ID | 2134 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2-Sp56tm1Osb | |
Internal Code | Sp56 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Zp3r |
Gene name | zona pellucida 3 receptor |
Allele symbol | Zp3rtm1 |
Allele name | zona pellucida 3 receptor, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:104965, |
Chromosome | 1 (56.89) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
#3878 | GCCATATGGCATCCACATTTGG |
#3881 | CCATCTGACCTTTTGGTAGGCTC |
#2726 | CTTTACGGTATCGCCGCTCCCGATT |
Author | Muro Y, Buffone MG, Okabe M, Gerton GL. |
Title | Function of the acrosomal matrix: zona pellucida 3 receptor (ZP3R/sp56) is not essential for mouse fertilization. |
Journal | Biol Reprod. |
Volume | 86(1) |
Page | 1-6 |
Year | 2012 |
PMID |
Disease name, Applicable field |