CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1736
Type of strain Targeted mutant.
Strain name B6;Cg-Atg5tm1Myok Spink3tm1(cre)Imeg
Internal Code Atg5 flox/-;Spink3-cre mouse
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method From other organizations
Origin (In-house) Organization Institute of Resource Development and Analysis, Kumamoto university
Organization code Card
Developer Ken-ichi Yamamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Spink3
Gene name serine peptidase inhibitor, Kazal type 3
Allele symbol Spink3tm1(cre)Imeg
Allele name serine peptidase inhibitor, Kazal type 3; targeted mutation 1, Institute of Molecular Embryology and Genetics
MGI
Chromosome 18 (23.47) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM
Gene symbol Atg5
Gene name autophagy-related 5
Allele symbol Atg5tm1Myok
Allele name autophagy-related 5; targeted mutation 1, Minesuke Yokoyama
MGI
Chromosome 10 (23.24) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
check2 acaacgtcgagcacagctgcgcaagg
short2 gtactgcataatggtttaactcttgc
PCR Primer 2
exon3-1 gaatatgaaggcacacccctgaaatg


References

Author Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki-Migishima R, Yokoyama M, Mishima K, Saito I, Okano H, Mizushima N
Title Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice.
Journal Nature
Volume 441
Page 885-9
Year 2006
PMID
Author Hashimoto D, Ohmuraya M, Hirota M, Yamamoto A, Suyama K, Ida S, Okumura Y, Takahashi E, Kido H, Araki K, Baba H, Mizushima N, Yamamura K.
Title Involvement of autophagy in trypsinogen activation within the pancreatic acinar cells.
Journal J Cell Biol.
Volume 181
Page 1065-72
Year 2008
PMID


Disease , Applicable field information

Disease name, Applicable field Digestive Disorders






Copyright @ 2021 Kumamoto University. All rights reserved.