CARD ID | 1748 | |
Type of strain | Gene trap. | |
Strain name | B6; CB-Fzr1/Cdh1GT(Cdh1 KI) | |
Internal Code | Fzrcdh1(GT(ResP17)) | |
Submitter | Saya Hideyuki | |
Submitter affiliation or code | Division of Gene Regulation, Institute for Advanced Medical Research,Keio University School of Medicine | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Fzr1 |
Gene name | fizzy/cell division cycle 20 related 1 (Drosophila) |
Allele symbol | |
Allele name | |
MGI | MGI:1926790, |
Chromosome | 10 , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
FzrORF-s | atggaccaggactatgagcg |
FzrORF-as | ctatcggatccgggtgaagag |
Author | Naoe H, Araki K, Nagano O, Kobayashi Y, Ishizawa J, Chiyoda T, Shimizu T, Sasaki Y, Yamamura KI, Saya H, Kuninaka S |
Title | The anaphase-promoting complex/cyclosome activator Cdh1 modulates RhoGTPase by targeting p190 RhoGAP for degradation. |
Journal | Mol. Cell. Biol. |
Volume | 30 |
Page | 3994-4005 |
Year | 2010 |
PMID |
Disease name, Applicable field |