CARD ID | 2576 | |
Type of strain | Transgenic., Targeted mutant. | |
Strain name | C57BL/6-Cyp19a1tm1(EGFP) | |
Internal Code | EGFP-ArKO | |
Submitter | TODA Katsumi | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
No condition
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Dep.Biochemistry,school of Medicine,Kochi University |
Organization code | ||
Developer | Katsumi Toda | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | - |
Gene name | - |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | |
OMIM |
Gene symbol | Cyp19a1 |
Gene name | cytochrome P450, family 19, subfamily a, polypeptide 1 |
Allele symbol | Cyp19a1tm1(EGFP) |
Allele name | cytochrome P450, family 19, subfamily a, polypeptide 1; targeted mutation 1, |
MGI | MGI:88587, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Maro8 | GCAGCCCCTGACACCATGTC |
Maro2 | AACTTTCATCATCACCATGGCGATGTACTT |
Author | Katsumi Toda, Yasushi Okada, Mohamad Zubair, Ken-Ichiro Morohashi, Toshiji Saibara, Teruhiko Okada |
Title | Aromatase-knockout mouse carrying an estrogen-inducible enhanced green fluorescent protein gene facilitates detection of estrogen actions in vivo |
Journal | Endocrinology |
Volume | 145 |
Page | 1800-1888 |
Year | 2004 |
PMID |
Disease name, Applicable field | Neurobiology, Dermatology, cancer, Immunology, Development, Anatomy, Physiology, Metabolism |