CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2576
Type of strain Transgenic., Targeted mutant.
Strain name C57BL/6-Cyp19a1tm1(EGFP)
Internal Code EGFP-ArKO
Submitter TODA Katsumi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions No condition
Production method in-house breeding
Origin (In-house) Organization Dep.Biochemistry,school of Medicine,Kochi University
Organization code
Developer Katsumi Toda
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol -
Gene name -
Allele symbol
Allele name
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method
OMIM
Gene symbol Cyp19a1
Gene name cytochrome P450, family 19, subfamily a, polypeptide 1
Allele symbol Cyp19a1tm1(EGFP)
Allele name cytochrome P450, family 19, subfamily a, polypeptide 1; targeted mutation 1,
MGI MGI:88587,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Maro8 GCAGCCCCTGACACCATGTC
Maro2 AACTTTCATCATCACCATGGCGATGTACTT


References

Author Katsumi Toda, Yasushi Okada, Mohamad Zubair, Ken-Ichiro Morohashi, Toshiji Saibara, Teruhiko Okada
Title Aromatase-knockout mouse carrying an estrogen-inducible enhanced green fluorescent protein gene facilitates detection of estrogen actions in vivo
Journal Endocrinology
Volume 145
Page 1800-1888
Year 2004
PMID


Disease , Applicable field information

Disease name, Applicable field Neurobiology, Dermatology, cancer, Immunology, Development, Anatomy, Physiology, Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.