CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2208
Type of strain Gene trap.
Strain name B6.Cg-Gt(pU-21T)536Card
Internal Code Ayu21-T536
Submitter Araki Kimi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization IRDA, Kumamoto University
Organization code Card
Developer Kimi Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol
Gene name
Allele symbol
Allele name
MGI
Chromosome 12 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Z-1 GCGTTACCCAACTTAATCG
Z-2 TGTGAGCGAGTAACAACCCG


Disease , Applicable field information

Disease name, Applicable field Development


EGTC

EGTC番号 21-T536




Copyright @ 2021 Kumamoto University. All rights reserved.