CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1127
Type of strain Gene trap.
Strain name B6;CB-Gt(pU-21T)261Imeg
Internal Code Ayu21-T261
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Institute of Molecular Embryology and Genetics Kumamoto University
Organization code
Developer Kimi Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol
Gene name
Allele symbol
Allele name
MGI
Chromosome X ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Z-1 GCGTTACCCAACTTAATCG
Z-2 TGTGAGCGAGTAACAACCCG


Disease , Applicable field information

Disease name, Applicable field Development


EGTC

EGTC番号 21-T261




Copyright @ 2021 Kumamoto University. All rights reserved.