| CARD ID | 2651 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6N-Vps52tm2.1Card | |
| Internal Code | Vps52VADmut | |
| Submitter | Araki Kimi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | Kimi Araki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Vps52 |
| Gene name | VPS52 GARP complex subunit |
| Allele symbol | Vps52tm2.1Card |
| Allele name | VPS52 GARP complex subunit, targeted mutation 2.1, |
| MGI | MGI:1330304, |
| Chromosome | 17 (17.98) (17qB1) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Vps52_genome_F18 | cctttgattctgattaagcctgc |
| Vps52VAD_R4 | tacccctgcaagttctgtca |
| Author | Michihiko Sugimoto, Masayo Kondo, Michiko Hirose, Misao Suzuki, Kazuyuki Mekada, Takaya Abe, Hiroshi Kiyonari, Atsuo Ogura, Nobuo Takagi, Karen Artzt, and Kuniya Abe |
| Title | Molecular Identification of tw5: Vps52 Promotes Pluripotential Cell Differentiation through Cell–Cell Interactions |
| Journal | Cell Reports |
| Volume | 2 |
| Page | 1363-1374 |
| Year | 2012 |
| PMID |
| Disease name, Applicable field | Development, Laboratory-animal Science, Hematology |