| CARD ID | 2251 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(CAG-LSL-p62)139Card | |
| Internal Code | CAG promoter-LSL-p62 line 139 | |
| Submitter | Ohmuraya Masaki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Institute of Resource Development and Analysis, Kumamoto University |
| Organization code | Card | |
| Developer | Masaki Ohmuraya | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sqstm1 |
| Gene name | sequestosome 1 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:107931, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | electroporation |
| OMIM |
| p62-F2 | gctgccctatacccacatct |
| Ag4 | accaccttctgataggcag |
| Disease name, Applicable field | Laboratory-animal Science, cancer, Digestive Disorders, Osteosis |