CARD ID | 2621 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2-Dnaic1em1(S124A,S127A)Osb | |
Internal Code | Dnaic1 S124A S127A KI | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Dnaic1 |
Gene name | dynein, axonemal, intermediate chain 1 |
Allele symbol | Dnaic1em1(S124A,S127A)Osb |
Allele name | dynein, axonemal, intermediate chain 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:1916172, |
Chromosome | 4 (21.75) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
Dnaic1Fw | AAGAATTCCAAAGACTCAGATGAAGGCCGT |
Dnaic1Rv | AAGGATCCCCCTGACCTGGTGAAATGGGTA |
Author | Young SA, Miyata H, Satouh Y, Kato H, Nozawa K, Isotani A, Aitken RJ, Baker MA, Ikawa M. |
Title | CRISPR/Cas9-Mediated Rapid Generation of Multiple Mouse Lines Identified Ccdc63 as Essential for Spermiogenesis. |
Journal | Int J Mol Sci. |
Volume | 16 |
Page | 24732-50 |
Year | 2015 |
PMID |
Disease name, Applicable field |