CARD ID | 2338 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-Gtsf1tm1Miya | |
Internal Code | Gtsf1 KO | |
Submitter | Miyazaki Jun-ichi | |
Submitter affiliation or code | Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | Miya | |
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Gtsf1 |
Gene name | Gametocyte specific factor 1 |
Allele symbol | Gtsf1tm1Miya |
Allele name | Gametocyte specific factor 1, targeted mutation 1, |
MGI | MGI:1921424, |
Chromosome | 15 (58.93) (15F3) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
110EX4A3 | TGTTTGTTTGTTTTCATGACAGGGTTTC |
Puro-S4 | ACCCGCAAGCCCGGTGCCTGA |
110INT3S3 | GGGGCACTGTAATAACTTTTCAGGGTCC |
Author | Yoshimura T, Miyazaki T, Toyoda S, Miyazaki S, Tashiro F, Yamato E, Miyazaki J |
Title | Gene expression pattern of Cue110: A member of the uncharacterized UPF0224 gene family preferentially expressed in germ cells |
Journal | Gene Expression Patterns |
Volume | 8 |
Page | 27-35 |
Year | 2007 |
PMID |
Author | Yoshimura T, Toyoda S, Kuramochi-Miyagawa S, Miyazaki T, Miyazaki S, Tashiro F, Yamato E, Nakano T, Miyazaki J |
Title | Gtsf1/Cue110, a gene encoding a protein with two copies of a CHHC Zn-finger motif, is involved in spermatogenesis and retrotransposon suppression in murine testes |
Journal | Developmental Biology |
Volume | 335 |
Page | 216-227 |
Year | 2009 |
PMID |
Disease name, Applicable field | Development, Reproduction |