CARD ID | 2893 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(eR1(+24m)-iC9-tdTomato)7-6 | |
Internal Code | eR1-iC9#7-6 | |
Submitter | Osato Motomi | |
Submitter affiliation or code | International Research Center for Medical Sciences, Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Cancer Science Institute of Singapore, National University of Singapore; International Research Center for Medical Sciences, Kumamoto University |
Organization code | ||
Developer | Motomi Osato | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | iC9-2A-tdTomato |
Gene name | inducible Caspase 9 - 2A - tandem dimeric Tomato fluorescent protein |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
eR1(+24m)-325FP | CACTGATAACGTGGGCAGCTT |
mhsp68-175RP | GTGTCCGGTGACGTGATCCTC |
Author | Ng CE, Yokomizo T, Yamashita N, Cirovic B, Jin H, Wen Z, Ito Y, Osato M. |
Title | A Runx1 intronic enhancer marks hemogenic endothelial cells and hematopoietic stem cells. |
Journal | Stem Cells |
Volume | 28(10) |
Page | 1869-81 |
Year | 2010 |
PMID |
Disease name, Applicable field | Digestive Disorders, Urology, cancer, Cell biology, Laboratory-animal Science, Development, Molecular biology, Aging, Respiratory System |