CARD ID | 2339 | |
Type of strain | Targeted mutant. | |
Strain name | DBA/2-Mcm3aptm1Imku | |
Internal Code | ganp-KO (DBA/2) | |
Submitter | Kuwahara Kazuhiko | |
Submitter affiliation or code | Aichi Cancer Center Research Institute | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Aichi Cancer Center Research Institute |
Organization code | ||
Developer | Kazuhiko Kuwahara | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Mcm3ap |
Gene name | minichromosome maintenance complex component 3 associated protein |
Allele symbol | Mcm3aptm1Imku |
Allele name | minichromosome maintenance complex component 3 associated protein; targeted mutation 1, Nobuo Sakaguchi |
MGI | MGI:1930089, |
Chromosome | 10 (38.88) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Neo 5'-int | GCAGCTGTGCTCGACGTTGT |
Neo 3'-int | GGCGATACCGTAAAGCACGA |
Author | Mikoto Yoshida, Kazuhiko Kuwahara, Tatsuya Shimasaki, Naomi Nakagata, Masao Matsuoka, and Nobuo Sakaguchi |
Title | GANP suppresses DNA recombination measured by direct-repeat beta-galactosidase gene-construct but not the immunoglobulin-gene-type recombination in mammalian cells. |
Journal | Genes to Cells |
Volume | 12 |
Page | 1205-1213 |
Year | 2007 |
PMID |
Disease name, Applicable field | Development, cancer |