| CARD ID | 249 | |
| Type of strain | Transgenic. | |
| Strain name | B6;BALB-Tg(0.6hTTRMet30)14Imeg | |
| Internal Code | , | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Institute for Molecular Embryology and Genetics |
| Organization code | IMEG | |
| Developer | Ken-ichi Yamamura | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ttr |
| Gene name | transthyretin Val 30 Met (Human) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:98865, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | |
| GO | Gene Ontology |
| OMIM | OMIM ID: 176300 Human Gene Symbol: TTR, |
| primerA | 5'(TCTCACGTGTCTTCTCTACA)3' |
| primerB | 3'(AGCCTCTCTCTACCAAGTGA)5' |
| Author | Hiromitsu Noguchi, Tadashi Kaname, Tomohisa Sekimoto, Kei Senba, Yasushi Nagata, Masatake Araki, Makoto Abe, Naomi Nakagata, Tomomichi Ono, Ken-ichi Yamamura and Kimi Araki |
| Title | Naso-maxillary deformity due to frontonasal expression of human transthyretin gene in transgenic mice |
| Journal | Genes to Cells |
| Volume | 7 |
| Page | 1087-1098 |
| Year | 2002 |
| PMID | 12354101 |
| Disease name, Applicable field | Development |