CARD ID | 2174 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6N-Tulp2tm1Osb/1B | |
Internal Code | Tulp2 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Tulp2 |
Gene name | tubby-like protein 2 |
Allele symbol | Tulp2tm1Osb |
Allele name | tubby-like protein 2; targeted mutation 1, Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University, |
MGI | MGI:1861600, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
#781 | GCTTGCCGAATATCATGGTGGAAAATGGCC |
#6165 | GGACTCATATTCCATCCGTAAGGGTGTC |
#6166 | CTCTGGCATCCGTGGATCCAACC |
Author | Yuki Oyama , Haruhiko Miyata , Keisuke Shimada , Tamara Larasati , Yoshitaka Fujihara , Masahito Ikawa |
Title | TULP2 deletion mice exhibit abnormal outer dense fiber structure and male infertility |
Journal | Reproductive Medicine and Biology |
Volume | 23;21(1) |
Page | e12467 |
Year | 2022 May |
PMID | 35619658 |
Disease name, Applicable field |