CARD ID | 780 | |
Type of strain | Transgenic. | |
Strain name | B6;C3H-Tg(K19-Wnt1)#7S | |
Internal Code | K19-Wnt1 | |
Submitter | Masanobu Oshima | |
Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Cancer Research Institute, Kanazawa Univ. |
Organization code | ||
Developer | Hiroko Oshima | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Wnt1 |
Gene name | wingless-related MMTV integration site 1 |
Allele symbol | |
Allele name | |
MGI | MGI:98953, |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
GO | Gene Ontology |
OMIM | OMIM ID: 164820 Human Gene Symbol: WNT1, |
Wnt1F | CGACCGTGTTCTCTGAGATG |
HA-R | CATCATATGGGTAGGCCATGG |
Author | Oshima H, Matsunaga A, Fujimura T, Tsukamoto T, Taketo MM, Oshima M. |
Title | Carcinogenesis in mouse stomach by simultaneous activation of the wnt signaling and prostaglandin e(2) pathway. |
Journal | Gastroenterology |
Volume | 131 |
Page | 1086-1095 |
Year | 2006 |
PMID |
Disease name, Applicable field | cancer |