CARD ID | 3160 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Gm28536em1 | |
Internal Code | Gm28536_del1 | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Gm28536 |
Gene name | predicted gene 28536 |
Allele symbol | Gm28536em1 |
Allele name | predicted gene 28536; endonuclease-mediated mutation 1, |
MGI | MGI:5579242, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Gm28536_F3 | actgtactccttcgcaattcatagctc |
Gm28536_R3 | GACTCCTAGTCCCACAGAGCTTC |
Disease name, Applicable field | Reproduction, Cell biology |