CARD R-BASE



Mouse strain


Strain information

CARD ID 2519
Type of strain Targeted mutant.
Strain name B6D2-4930522H14Rikem1Osb
Internal Code 4930522H14Rik KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol 4930522H14Rik
Gene name RIKEN cDNA 4930522H14 gene
Allele symbol 4930522H14Rikem1Osb
Allele name RIKEN cDNA 4930522H14 gene, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1914896,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
GTGGCTTTGATTTGGGGAAATGGAGAGC
GCACCACCCGCAACATACCACC


References

Author Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.
Journal Proc Natl Acad Sci U S A.
Volume 113(28)
Page 7704-10
Year 2016
PMID 27357688


Disease , Applicable field information

Disease name, Applicable field


EGTC

EGTC番号




Copyright @ 2021 Kumamoto University. All rights reserved.