| CARD ID | 2144 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Tepptm1a(KOMP)Osb/88 | |
| Internal Code | Tepp KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Tepp |
| Gene name | testis, prostate and placenta expressed |
| Allele symbol | Tepptm1a(KOMP)Osb |
| Allele name | testis, prostate and placenta expressed, targeted mutation 1a,Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| MGI | MGI:1920657, |
| Chromosome | 8 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| #5083 | actgatggcgagctcagacc |
| #5381 | tcaactatctgactccctgg |
| #5862 | gagtatcttggagtccccatctcaccc |
| #5863 | ggatcttggttaggggttgcaagcg |
| Author | H. Miyata, J.M. Castaneda, Y. Fujihara, Z. Yu, D.R. Archambeault, A. Isotani, D. Kiyozumi, M.L. Kriseman, D. Mashiko, T. Matsumura, R.M. Matzuk, M. Mori, T. Noda, A. Oji, M. Okabe, R. Prunskaite-Hyyrylainen, R. Ramirez-Solis, Y. Satouh, Q. Zhang, M. Ikawa, M.M. Matzuk |
| Title | Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice |
| Journal | Proc. Natl. Acad. Sci. |
| Volume | 113 |
| Page | 7704-7710 |
| Year | 2016 |
| PMID |
| Disease name, Applicable field | Development |