CARD ID | 1900 | |
Type of strain | Transgenic. | |
Strain name | FVB-Tg(hPRSS8)47879/Card | |
Internal Code | FVB Tg hPRSS8-47879 | |
Submitter | - - | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Department of Molecular Biology and Microbiology, and Biomolecular Science Center, University of Central Florida, Orlando, Florida |
Organization code | ||
Developer | Karl X. Chai | |
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | hPRSS8 |
Gene name | human prostasin |
Allele symbol | |
Allele name | transgene insertion, Karl X. , Department of Molecular Biology and Microbiology, and Biomolecular Science Center, University of Central Florida |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
H. pro-rat-kpnl-s | 5CTCCTCCAACTCAGCAGACC |
Human PRSS8 RT-PCR-A | 5GAGAGATGTGCTCATCAGTCTGG |
Author | Li-Mei Chen, Cindy Wang, Mengqian Chen, Matthew R. Marcello, Julie Chao, Lee Chao and Karl X. Chai |
Title | Prostasin attenuates inducible nitric oxide synthase expression in lipopolysaccharide-induced urinary bladder inflammation |
Journal | Am J Physiol Renal Physiol |
Volume | 291 |
Page | F567-F577 |
Year | 2006 |
PMID |
Disease name, Applicable field | Unknown |