CARD ID | 1824 | |
Type of strain | Transgenic. | |
Strain name | B6;D2-Tg(CAG/CAT-tvA)P2Tama | |
Internal Code | B6;D2-Tg(CAG/CAT/tvA)P2 | |
Submitter | Esumi Shigeyuki | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
Need acknowledgement in publishing paper. |
|
Production method | From other organizations | |
Origin (In-house) | Organization | Deparatment of Morphological Neural Science, Graduate School of Medicine, Kumamoto University |
Organization code | Tama | |
Developer | Nobuaki Tamamaki | |
Origin (From other organizations) | Organization | Kyoto Univ. |
Organization code | ||
Developer | Nobuaki tamamaki | |
Year introduced | 2004 / 6 | |
Introduced Generation | ||
Remarks | Need contact to Nobuaki Tamamaki ( tamamaki@kumamoto-u.ac.jp ). Need acknowledgement in publication. |
Gene symbol | tvA |
Gene name | tv-A800 |
Allele symbol | Tg(CAG/CAT-tvA)P2Tama |
Allele name | transgene insertion P2, Nobuaki Tamamaki |
MGI | |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
tvaup | ATGGCGCGGCTGCTGCCCGCGCT |
tvalow | TTATCAGTCCCATCTCACCAGCT |
Author | Shengxi Wu, Shigeyuki Esumi, Keisuke Watanabe, Jing Chen, Kouichi C. Nakamura, Kazuhiro Nakamura, Kouhei Kometani, Nagahiro Minato, Yuchio Yanagawa, Kaori Akashi, Kenji Sakimura, Takeshi Kaneko and Nobuaki Tamamaki |
Title | Tangential migration and proliferation of intermediate progenitors of GABAergic neurons in the mouse telencephalon |
Journal | Development |
Volume | 138 |
Page | 2499-2509 |
Year | 2011 |
PMID |
Disease name, Applicable field | Molecular biology, Development, Laboratory-animal Science, Cell biology, Neurobiology |