CARD ID | 1993 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-Gt(ROSA26) | |
Internal Code | GO-ATeam1 | |
Submitter | Yamamoto Masamichi | |
Submitter affiliation or code | Gunma University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. For use of the BIOLOGICAL RESOURCE by a for-profit institution, the RECIPIENT must reach agreement on terms and conditions of use of it with DEPOSITOR and must obtain a prior written consent from the DEPOSITOR. The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use based on the results from the use of the BIOLOGICAL RESOURCE. |
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | 2011 | |
Introduced Generation | ||
Remarks |
Gene symbol | ROSA26 |
Gene name | ROSA26 |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
448_GO-ATeam2_F | CCCGCGCCGAGGTGAAG |
319_ pA-R1 | CCTAAAAAGAGTCACAGTCCTGACC |
Disease name, Applicable field |